1. A
   Both Statement I and Statement II are true
2. B
   Both Statement I and Statement II are false
3. C
   Statement I is true but Statement II is false
4. D
   Statement I is false but Statement II is true

Tap an option to check your answer.

1. A
   A bio-reactor provides optimal growth conditions for achieving the desired product
2. B
   Most commonly used bio-reactors are of stirring type
3. C
   Bio-reactors are used to produce small scale bacterial cultures
4. D
   Bio-reactors have an agitator system, an oxygen delivery system and foam control system

Tap an option to check your answer.

1. A
   5'AUGUACCGUUUAUAGGUAAGU3'
2. B
   5'AUGUAAAGUUUAUAGGUAAGU3'
3. C
   5'AUGUACCGUUUAUAGGGAAGU3'
4. D
   5'ATGTACCGTTTATAGGTAAGT3'

Tap an option to check your answer.

1. A
   Both A and R are true and R is the correct explanation of A
2. B
   Both A and R are true but R is NOT the correct explanation of A
3. C
   A is true but R is false
4. D
   A is false but R is true

Tap an option to check your answer.

1. A
   A-I, B-III, C-II, D-IV
2. B
   A-IV, B-III, C-I, D-II
3. C
   A-III, B-I, C-IV, D-II
4. D
   A-II, B-IV, C-III, D-I

Tap an option to check your answer.

1. A
   E-C-A-D-B
2. B
   A-E-C-B-D
3. C
   B-D-E-C-A
4. D
   E-A-D-B-C

Tap an option to check your answer.

1. A
   A-IV, B-II, C-III, D-I
2. B
   A-I, B-II, C-IV, D-III
3. C
   A-II, B-IV, C-I, D-III
4. D
   A-IV, B-III, C-II, D-I

Tap an option to check your answer.

1. A
   (a) Smooth - Toes, (b) Skeletal – Legs, (c) Cardiac – Heart
2. B
   (a) Skeletal - Triceps, (b) Smooth – Stomach, (c) Cardiac – Heart
3. C
   (a) Skeletal - Biceps, (b) Involuntary – Intestine, (c) Smooth – Heart
4. D
   (a) Involuntary – Nose tip, (b) Skeletal – Bone, (c) Cardiac – Heart

Tap an option to check your answer.

1. A
   A-III, B-I, C-II, D-IV
2. B
   A-I, B-III, C-IV, D-II
3. C
   A-IV, B-I, C-II, D-III
4. D
   A-III, B-I, C-IV, D-II

Tap an option to check your answer.

1. A
   A-IV, B-II, C-III, D-I
2. B
   A-III, B-II, C-I, D-IV
3. C
   A-II, B-IV, C-I, D-III
4. D
   A-IV, B-I, C-III, D-II

Tap an option to check your answer.

1. A
   Both A and R are correct and R is the correct explanation of A
2. B
   Both A and R are correct but R is NOT the correct explanation of A
3. C
   A is correct but R is not correct
4. D
   A is not correct but R is correct

Tap an option to check your answer.

1. A
   D-A-C-B
2. B
   B-A-D-C
3. C
   C-B-D-A
4. D
   A-D-C-B

Tap an option to check your answer.

1. A
   A-IV, B-III, C-II, D-I
2. B
   A-IV, B-II, C-III, D-I
3. C
   A-II, B-IV, C-I, D-III
4. D
   A-II, B-I, C-IV, D-III

Tap an option to check your answer.

1. A
   A-II, B-I, C-III, D-IV
2. B
   A-III, B-I, C-II, D-IV
3. C
   A-IV, B-I, C-II, D-III
4. D
   A-III, B-II, C-I, D-IV

Tap an option to check your answer.

1. A
   A-II, B-I, C-IV, D-III
2. B
   A-III, B-I, C-II, D-IV
3. C
   A-III, B-IV, C-I, D-II
4. D
   A-II, B-IV, C-I, D-III

Tap an option to check your answer.

1. A
   Tumour inhibiting plasmid
2. B
   Tumor independent plasmid
3. C
   Tumor inducing plasmid
4. D
   Temperature independent plasmid

Tap an option to check your answer.

1. A
   A-IV, B-II, C-III, D-I
2. B
   A-II, B-I, C-IV, D-III
3. C
   A-II, B-IV, C-I, D-III
4. D
   A-IV, B-III, C-II, D-I

Tap an option to check your answer.

1. A
   Coitus interruptus
2. B
   Periodic abstinence
3. C
   Lactational amenorrhea
4. D
   Vaults

Tap an option to check your answer.

1. A
   C-E-D-A-B
2. B
   E-B-D-A-C
3. C
   B-D-E-A-C
4. D
   E-C-A-D-B

Tap an option to check your answer.

1. A
   Genetic recombination
2. B
   Genetic drift
3. C
   Gene migration
4. D
   Constant gene pool

Tap an option to check your answer.

1. A
   A-II, B-III, C-I, D-IV
2. B
   A-III, B-IV, C-II, D-I
3. C
   A-I, B-III, C-II, D-IV
4. D
   A-II, B-I, C-III, D-IV

Tap an option to check your answer.

1. A
   A-II, B-IV, C-I, D-III
2. B
   A-III, B-II, C-IV, D-I
3. C
   A-II, B-I, C-IV, D-III
4. D
   A-I, B-III, C-II, D-IV

Tap an option to check your answer.

1. A
   A, B & D only
2. B
   A, B & E only
3. C
   B, C & E only
4. D
   C, D & E only

Tap an option to check your answer.

1. A
   Uterine fundus
2. B
   Isthmus
3. C
   Infundibulum
4. D
   Ampulla

Tap an option to check your answer.

1. A
   A-IV, B-II, C-III, D-I
2. B
   A-I, B-III, C-II, D-IV
3. C
   A-II, B-III, C-I, D-IV
4. D
   A-III, B-I, C-IV, D-II

Tap an option to check your answer.