PYQ Vault

NEET (UG) 2024 question paper

200 questions · 800 marks · 200 minutes · +4 per correct answer, -1 per wrong one

Every question in the order it was set, free to read. Tap an option to check it, or open the answer and worked solution. Answers open as you go; sign in free to keep opening them.

Sit it as a timed mock

Physics

50 questions

  1. 1
    A logic circuit provides the output YY as per the following truth table:
    ABY
    001
    010
    101
    110
    The expression for the output YY is:

    Tap an option to check your answer.

  2. 2
    A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is vv in the direction shown, which one of the following options is correct (PP and QQ are any highest and lowest points on the wheel, respectively)?

    Tap an option to check your answer.

  3. 3
    In the following circuit, the equivalent capacitance between terminal AA and terminal BB is:

    Tap an option to check your answer.

  4. 4
    At any instant of time tt, the displacement of any particle is given by 2t−12t - 1 (SI unit) under the influence of force of 5 N. The value of instantaneous power is (in SI unit):

    Tap an option to check your answer.

  5. 5
    Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: The potential (VV) at any axial point, at 2 m distance (rr) from the centre of the dipole of dipole moment vector P⃗\vec{P} of magnitude, 4×10−64 \times 10^{-6} C m, is ±9×103\pm 9 \times 10^{3} V. (Take 14πϵ0=9×109\frac{1}{4\pi \epsilon_0} = 9 \times 10^{9} SI units) Reason R: V=±2P4πϵ0r2V = \pm \frac{2P}{4\pi \epsilon_0 r^2}, where rr is the distance of any axial point, situated at 2 m from the centre of the dipole. In the light of the above statements, choose the correct answer from the options given below:

    Tap an option to check your answer.

  6. 6
    Two bodies AA and BB of same mass undergo completely inelastic one dimensional collision. The body AA moves with velocity v1v_1 while body BB is at rest before collision. The velocity of the system after collision is v2v_2. The ratio v1:v2v_1 : v_2 is

    Tap an option to check your answer.

  7. 7
    In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is 9.8×10−69.8 \times 10^{-6} kg m2^2. If the magnitude of magnetic moment of the needle is x×10−5x \times 10^{-5} Am2^2, then the value of 'xx' is:

    Tap an option to check your answer.

  8. 8
    An unpolarised light beam strikes a glass surface at Brewster's angle. Then

    Tap an option to check your answer.

  9. 9
    Consider the following statements A and B and identify the correct answer: (The given I-V graph has quadrants labelled (I), (II), (III), (IV).) A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph. B. In a reverse biased pnpn junction diode, the current measured in (μA\mu A), is due to majority charge carriers.

    Tap an option to check your answer.

  10. 10
    The graph which shows the variation of (1λ2)\left(\frac{1}{\lambda^2}\right) and its kinetic energy, EE is (where λ\lambda is de Broglie wavelength of a free particle):

    Tap an option to check your answer.

  11. 11
    The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 Ω\Omega, when connected through an external resistance of 4 Ω\Omega as shown in the figure is:

    Tap an option to check your answer.

  12. 12
    The quantities which have the same dimensions as those of solid angle are:

    Tap an option to check your answer.

  13. 13
    In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

    Tap an option to check your answer.

  14. 14
    The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is 2400 g cm2^2. The length of the 400 g rod is nearly:

    Tap an option to check your answer.

  15. 15
    If x=5sin⁡(πt+π3)x = 5\sin\left(\pi t + \frac{\pi}{3}\right) m represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are

    Tap an option to check your answer.

  16. 16
    The mass of a planet is 110\frac{1}{10}th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:

    Tap an option to check your answer.

  17. 17
    A horizontal force 10 N is applied to a block AA as shown in figure. The mass of blocks AA and BB are 2 kg and 3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block AA on block BB is:

    Tap an option to check your answer.

  18. 18
    A thermodynamic system is taken through the cycle abcdaabcda. The work done by the gas along the path bcbc is:

    Tap an option to check your answer.

  19. 19
    Given below are two statements: Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges. Statement II: Atoms of each element are stable and emit their characteristic spectrum. In the light of the above statements, choose the most appropriate answer from the options given below.

    Tap an option to check your answer.

  20. 20
    82290X→αY→e+Z→β−P→e−Q^{290}_{82}X \xrightarrow{\alpha} Y \xrightarrow{e^+} Z \xrightarrow{\beta^-} P \xrightarrow{e^-} Q In the nuclear emission stated above, the mass number and atomic number of the product QQ respectively, are

    Tap an option to check your answer.

  21. 21
    A particle moving with uniform speed in a circular path maintains:

    Tap an option to check your answer.

  22. 22
    A light ray enters through a right angled prism at point PP with the angle of incidence 30∘30^\circ as shown in figure. It travels through the prism parallel to its base BCBC and emerges along the face ACAC. The refractive index of the prism is:

    Tap an option to check your answer.

  23. 23
    In a vernier callipers, (N+1N + 1) divisions of vernier scale coincide with NN divisions of main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is:

    Tap an option to check your answer.

  24. 24
    If the monochromatic source in Young's double slit experiment is replaced by white light, then

    Tap an option to check your answer.

  25. 25
    If cc is the velocity of light in free space, the correct statements about photon among the following are: A. The energy of a photon is E=hνE = h\nu. B. The velocity of a photon is cc. C. The momentum of a photon, p=hνcp = \frac{h\nu}{c}. D. In a photon-electron collision, both total energy and total momentum are conserved. E. Photon possesses positive charge. Choose the correct answer from the options given below:

    Tap an option to check your answer.

  26. 26
    The output (YY) of the given logic gate is similar to the output of an/a

    Tap an option to check your answer.

  27. 27
    Match List I with List II.
    List I (Spectral Lines of Hydrogen for transitions from)List II (Wavelengths (nm))
    A. n2=3n_2 = 3 to n1=2n_1 = 2I. 410.2
    B. n2=4n_2 = 4 to n1=2n_1 = 2II. 434.1
    C. n2=5n_2 = 5 to n1=2n_1 = 2III. 656.3
    D. n2=6n_2 = 6 to n1=2n_1 = 2IV. 486.1
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  28. 28
    A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 N m−1^{-1}, then the excess force required to take it away from the surface is

    Tap an option to check your answer.

  29. 29
    In an ideal transformer, the turns ratio is NPNS=12\frac{N_P}{N_S} = \frac{1}{2}. The ratio VS:VPV_S : V_P is equal to (the symbols carry their usual meaning):

    Tap an option to check your answer.

  30. 30
    The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young's modulus, respectively, are 8×1088 \times 10^{8} N m−2^{-2} and 2×10112 \times 10^{11} N m−2^{-2}, is:

    Tap an option to check your answer.

  31. 31
    A thin spherical shell is charged by some source. The potential difference between the two points CC and PP (in V) shown in the figure is: (Take 14πε0=9×109\frac{1}{4\pi \varepsilon_0} = 9 \times 10^{9} SI units; R=3R = 3 cm, q=1 μCq = 1\ \mu C)

    Tap an option to check your answer.

  32. 32
    A wire of length 'll' and resistance 100 Ω\Omega is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

    Tap an option to check your answer.

  33. 33
    A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as 4π×10−74\pi \times 10^{-7} SI units):

    Tap an option to check your answer.

  34. 34
    Match List-I with List-II.
    List-I (Material)List-II (Susceptibility χ\chi)
    A. DiamagneticI. χ=0\chi = 0
    B. FerromagneticII. 0>χ≥−10 > \chi \geq -1
    C. ParamagneticIII. χ≫1\chi \gg 1
    D. Non-magneticIV. 0<χ<ε0 < \chi < \varepsilon (a small positive number)
    Choose the correct answer from the options given below

    Tap an option to check your answer.

  35. 35
    A bob is whirled in a horizontal plane by means of a string with an initial speed of ω\omega rpm. The tension in the string is TT. If speed becomes 2ω2\omega while keeping the same radius, the tension in the string becomes:

    Tap an option to check your answer.

  36. 36
    A parallel plate capacitor is charged by connecting it to a battery through a resistor. If II is the current in the circuit, then in the gap between the plates:

    Tap an option to check your answer.

  37. 37
    A 10 μF\mu F capacitor is connected to a 210 V, 50 Hz source as shown in figure. The peak current in the circuit is nearly (π=3.14\pi = 3.14):

    Tap an option to check your answer.

  38. 38
    If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is x2\frac{x}{2} times its original time period. Then the value of xx is:

    Tap an option to check your answer.

  39. 39
    The following graph represents the TT-VV curves of an ideal gas (where TT is the temperature and VV the volume) at three pressures P1P_1, P2P_2 and P3P_3 compared with those of Charles's law represented as dotted lines. Then the correct relation is:

    Tap an option to check your answer.

  40. 40
    The minimum energy required to launch a satellite of mass mm from the surface of earth of mass MM and radius RR in a circular orbit at an altitude of 2R2R from the surface of the earth is:

    Tap an option to check your answer.

  41. 41
    The property which is not of an electromagnetic wave travelling in free space is that:

    Tap an option to check your answer.

  42. 42
    Choose the correct circuit which can achieve the bridge balance. (Each option shows a Wheatstone bridge with resistances 10 Ω10\ \Omega, 10 Ω10\ \Omega, 15 Ω15\ \Omega, 5 Ω5\ \Omega, a galvanometer GG, a diode DD, cell EE and key KK.)

    Tap an option to check your answer.

  43. 43
    A force defined by F=αt2+βtF = \alpha t^2 + \beta t acts on a particle at a given time tt. The factor which is dimensionless, if α\alpha and β\beta are constants, is:

    Tap an option to check your answer.

  44. 44
    Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

    Tap an option to check your answer.

  45. 45
    An iron bar of length LL has magnetic moment MM. It is bent at the middle of its length such that the two arms make an angle 60∘60^\circ with each other. The magnetic moment of this new magnet is:

    Tap an option to check your answer.

  46. 46
    A metallic bar of Young's modulus, 0.5×10110.5 \times 10^{11} N m−2^{-2} and coefficient of linear thermal expansion 10−510^{-5} ∘^\circC−1^{-1}, length 1 m and area of cross-section 10−310^{-3} m2^2 is heated from 0∘^\circC to 100∘^\circC without expansion or bending. The compressive force developed in it is:

    Tap an option to check your answer.

  47. 47
    The velocity (vv) - time (tt) plot of the motion of a body is shown below (a trapezoidal shape: rising, then constant, then falling). The acceleration (aa) - time (tt) graph that best suits this motion is:

    Tap an option to check your answer.

  48. 48
    If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then A. the charge stored in it, increases. B. the energy stored in it, decreases. C. its capacitance increases. D. the ratio of charge to its potential remains the same. E. the product of charge and voltage increases. Choose the most appropriate answer from the options given below:

    Tap an option to check your answer.

  49. 49
    A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for viewing a distant object is:

    Tap an option to check your answer.

  50. 50
    A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to: A. hold the sheet there if it is magnetic. B. hold the sheet there if it is non-magnetic. C. move the sheet away from the pole with uniform velocity if it is conducting. D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar. Choose the correct statement(s) from the options given below:

    Tap an option to check your answer.

Chemistry

50 questions

  1. 51
    Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si Choose the correct answer from the options given below:

    Tap an option to check your answer.

  2. 52
    Identify the correct reagents that would bring about the following transformation. (Phenyl)−CH2−CH=CH2→-CH_2-CH=CH_2 \to (Phenyl)−CH2−CH2−CHO-CH_2-CH_2-CHO

    Tap an option to check your answer.

  3. 53
    The compound that will undergo SN1S_N1 reaction with the fastest rate is

    Tap an option to check your answer.

  4. 54
    For the reaction 2A⇌B+C2A \rightleftharpoons B + C, KC=4×10−3K_C = 4 \times 10^{-3}. At a given time, the composition of reaction mixture is: [A]=[B]=[C]=2×10−3[A] = [B] = [C] = 2 \times 10^{-3} M. Then, which of the following is correct?

    Tap an option to check your answer.

  5. 55
    The highest number of helium atoms is in

    Tap an option to check your answer.

  6. 56
    Match List I with List II.
    List-I (Process)List-II (Conditions)
    A. Isothermal processI. No heat exchange
    B. Isochoric processII. Carried out at constant temperature
    C. Isobaric processIII. Carried out at constant volume
    D. Adiabatic processIV. Carried out at constant pressure
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  7. 57
    The energy of an electron in the ground state (n = 1) for He+He^+ ion is −x-x J, then that for an electron in n = 2 state for Be3+Be^{3+} ion in J is

    Tap an option to check your answer.

  8. 58
    Match List I with List II.
    List-I (Molecule)List-II (Number and types of bond/s between two carbon atoms)
    A. ethaneI. one σ\sigma-bond and two π\pi-bonds
    B. etheneII. two π\pi-bonds
    C. carbon molecule, C2C_2III. one σ\sigma-bond
    D. ethyneIV. one σ\sigma-bond and one π\pi-bond
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  9. 59
    Match List I with List II.
    List-I (Compound)List-II (Shape/geometry)
    A. NH3NH_3I. Trigonal Pyramidal
    B. BrF5BrF_5II. Square Planar
    C. XeF4XeF_4III. Octahedral
    D. SF6SF_6IV. Square Pyramidal
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  10. 60
    The E∘E^\circ value for the Mn3+/Mn2+Mn^{3+}/Mn^{2+} couple is more positive than that of Cr3+/Cr2+Cr^{3+}/Cr^{2+} or Fe3+/Fe2+Fe^{3+}/Fe^{2+} due to change of

    Tap an option to check your answer.

  11. 61
    In which of the following equilibria, KpK_p and KcK_c are NOT equal?

    Tap an option to check your answer.

  12. 62
    Among Group 16 elements, which one does NOT show −2-2 oxidation state?

    Tap an option to check your answer.

  13. 63
    'Spin only' magnetic moment is same for which of the following ions? A. Ti3+Ti^{3+} B. Cr2+Cr^{2+} C. Mn2+Mn^{2+} D. Fe2+Fe^{2+} E. Sc3+Sc^{3+} Choose the most appropriate answer from the options given below.

    Tap an option to check your answer.

  14. 64
    A compound with a molecular formula of C6H14C_6H_{14} has two tertiary carbons. Its IUPAC name is :

    Tap an option to check your answer.

  15. 65
    Given below are two statements: Statement I : The boiling point of three isomeric pentanes follows the order n-pentane > isopentane > neopentane Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point. In the light of the above statements, choose the most appropriate answer from the options given below:

    Tap an option to check your answer.

  16. 66
    Which plot of ln k vs 1T\dfrac{1}{T} is consistent with Arrhenius equation? (1) a straight line of positive slope passing through origin (2) a straight line of positive slope with positive intercept (3) a straight line of positive slope passing through origin (4) a straight line of negative slope with positive intercept

    Tap an option to check your answer.

  17. 67
    The Henry's law constant (KH)(K_H) values of three gases (A, B, C) in water are 145, 2×10−52 \times 10^{-5} and 35 kbar, respectively. The solubility of these gases in water follow the order:

    Tap an option to check your answer.

  18. 68
    Fehling's solution 'A' is

    Tap an option to check your answer.

  19. 69
    Given below are two statements: Statement I: The boiling point of hydrides of Group 16 elements follow the order H2O>H2Te>H2Se>H2SH_2O > H_2Te > H_2Se > H_2S. Statement II: On the basis of molecular mass, H2OH_2O is expected to have lower boiling point than the other members of the group but due to the presence of extensive H-bonding in H2OH_2O, it has higher boiling point. In the light of the above statements, choose the correct answer from the options given below:

    Tap an option to check your answer.

  20. 70
    Given below are two statements : Statement I: Both [Co(NH3)6]3+[Co(NH_3)_6]^{3+} and [CoF6]3−[CoF_6]^{3-} complexes are octahedral but differ in their magnetic behaviour. Statement II: [Co(NH3)6]3+[Co(NH_3)_6]^{3+} is diamagnetic whereas [CoF6]3−[CoF_6]^{3-} is paramagnetic. In the light of the above statements, choose the correct answer from the options given below:

    Tap an option to check your answer.

  21. 71
    The most stable carbocation among the following is :

    Tap an option to check your answer.

  22. 72
    On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as

    Tap an option to check your answer.

  23. 73
    Match List I with List II.
    List I (Complex)List II (Type of isomerism)
    A. [Co(NH3)5(NO2)]Cl2[Co(NH_3)_5(NO_2)]Cl_2I. Solvate isomerism
    B. [Co(NH3)5(SO4)]Br[Co(NH_3)_5(SO_4)]BrII. Linkage isomerism
    C. [Co(NH3)6][Cr(CN)6][Co(NH_3)_6][Cr(CN)_6]III. Ionization isomerism
    D. [Co(H2O)6]Cl3[Co(H_2O)_6]Cl_3IV. Coordination isomerism
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  24. 74
    The reagents with which glucose does not react to give the corresponding tests/products are A. Tollen's reagent B. Schiff's reagent C. HCN D. NH2OHNH_2OH E. NaHSO3NaHSO_3 Choose the correct options from the given below:

    Tap an option to check your answer.

  25. 75
    Match List I with List II.
    List I (Reaction)List II (Reagents/Condition)
    A. cyclohexylidenecyclohexane →\to 2 cyclohexanoneI. C6H5COClC_6H_5COCl/Anhyd. AlCl3AlCl_3
    B. benzene →\to benzophenone (diphenyl ketone)II. CrO3CrO_3
    C. cyclohexanol →\to cyclohexanoneIII. KMnO4/KOH,ΔKMnO_4/KOH, \Delta
    D. ethylbenzene →\to benzoic acidIV. (i) O3O_3 (ii) Zn−H2OZn-H_2O
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  26. 76
    Activation energy of any chemical reaction can be calculated if one knows the value of

    Tap an option to check your answer.

  27. 77
    Match List I with List II.
    List I (Conversion)List II (Number of Faraday required)
    A. 1 mol of H2OH_2O to O2O_2I. 3F
    B. 1 mol of MnO4−MnO_4^- to Mn2+Mn^{2+}II. 2F
    C. 1.5 mol of Ca from molten CaCl2CaCl_2III. 1F
    D. 1 mol of FeO to Fe2O3Fe_2O_3IV. 5F
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  28. 78
    Intramolecular hydrogen bonding is present in (1) o-nitrophenol (2) p-nitrophenol (3) m-nitrophenol (4) HF

    Tap an option to check your answer.

  29. 79
    Given below are two statements: Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II : Aniline cannot be prepared through Gabriel synthesis. In the light of the above statements, choose the correct answer from the options given below:

    Tap an option to check your answer.

  30. 80
    Which one of the following alcohols reacts instantaneously with Lucas reagent?

    Tap an option to check your answer.

  31. 81
    Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N Choose the correct answer from the options given below:

    Tap an option to check your answer.

  32. 82
    Which reaction is NOT a redox reaction?

    Tap an option to check your answer.

  33. 83
    Match List I with List II
    List I (Quantum Number)List II (Information provided)
    A. mlm_lI. Shape of orbital
    B. msm_sII. Size of orbital
    C. lIII. Orientation of orbital
    D. nIV. Orientation of spin of electron
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  34. 84
    In which of the following processes entropy increases? A. A liquid evaporates to vapour. B. Temperature of a crystalline solid lowered from 130 K to 0 K. C. 2NaHCO3(s)→Na2CO3(s)+CO2(g)+H2O(g)2NaHCO_{3(s)} \to Na_2CO_{3(s)} + CO_{2(g)} + H_2O_{(g)} D. Cl2(g)→2Cl(g)Cl_{2(g)} \to 2Cl_{(g)} Choose the correct answer from the options given below:

    Tap an option to check your answer.

  35. 85
    1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to

    Tap an option to check your answer.

  36. 86
    The products A and B obtained in the following reactions, respectively, are 3ROH+PCl3→3RCl+A3ROH + PCl_3 \to 3RCl + A ROH+PCl5→RCl+HCl+BROH + PCl_5 \to RCl + HCl + B

    Tap an option to check your answer.

  37. 87
    Major products A and B formed in the following reaction sequence, are (2-methylcyclohexan-1-ol) →PBr3\xrightarrow{PBr_3} A (major) →alc. KOH, Δ\xrightarrow{\text{alc. KOH},\ \Delta} B (major)

    Tap an option to check your answer.

  38. 88
    Identify the major product C formed in the following reaction sequence: CH3−CH2−CH2−I→NaCNA→Partial hydrolysisOH−B→Br2NaOHCCH_3-CH_2-CH_2-I \xrightarrow{NaCN} A \xrightarrow[\text{Partial hydrolysis}]{OH^-} B \xrightarrow[Br_2]{NaOH} C (major)

    Tap an option to check your answer.

  39. 89
    During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe2+Fe^{2+} ion?

    Tap an option to check your answer.

  40. 90
    Consider the following reaction in a sealed vessel at equilibrium with concentrations of N2=3.0×10−3N_2 = 3.0 \times 10^{-3} M, O2=4.2×10−3O_2 = 4.2 \times 10^{-3} M and NO = 2.8×10−32.8 \times 10^{-3} M. 2NO(g)⇌N2(g)+O2(g)2NO_{(g)} \rightleftharpoons N_{2(g)} + O_{2(g)} If 0.1 mol L−1L^{-1} of NO(g)NO_{(g)} is taken in a closed vessel, what will be degree of dissociation (α)(\alpha) of NO(g)NO_{(g)} at equilibrium?

    Tap an option to check your answer.

  41. 91
    The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere is (Given R = 2.0 cal K−1K^{-1} mol−1mol^{-1})

    Tap an option to check your answer.

  42. 92
    Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given : Molar mass of Cu : 63 g mol−1mol^{-1}, 1 F = 96487 C)

    Tap an option to check your answer.

  43. 93
    The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of activation. Given R = 8.314 J K−1K^{-1} mol−1mol^{-1}, log4 = 0.6021

    Tap an option to check your answer.

  44. 94
    The plot of osmotic pressure (Π)(\Pi) vs concentration (mol L−1L^{-1}) for a solution gives a straight line with slope 25.73 L bar mol−1mol^{-1}. The temperature at which the osmotic pressure measurement is done is (Use R = 0.083 L bar mol−1mol^{-1} K−1K^{-1})

    Tap an option to check your answer.

  45. 95
    Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI. A. Al3+Al^{3+} B. Cu2+Cu^{2+} C. Ba2+Ba^{2+} D. Co2+Co^{2+} E. Mg2+Mg^{2+} Choose the correct answer from the options given below.

    Tap an option to check your answer.

  46. 96
    Given below are two statements : Statement I : [Co(NH3)6]3+[Co(NH_3)_6]^{3+} is a homoleptic complex whereas [Co(NH3)4Cl2]+[Co(NH_3)_4Cl_2]^+ is a heteroleptic complex. Statement II : Complex [Co(NH3)6]3+[Co(NH_3)_6]^{3+} has only one kind of ligands but [Co(NH3)4Cl2]+[Co(NH_3)_4Cl_2]^+ has more than one kind of ligands. In the light of the above statements, choose the correct answer from the options given below.

    Tap an option to check your answer.

  47. 97
    The pair of lanthanoid ions which are diamagnetic is

    Tap an option to check your answer.

  48. 98
    For the given reaction: (cyclohexyl)−CH=CH−-CH=CH-(cyclohexyl) →KMnO4/H+\xrightarrow{KMnO_4/H^+} 'P' (major product) 'P' is

    Tap an option to check your answer.

  49. 99
    Identify the correct answer.

    Tap an option to check your answer.

  50. 100
    A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of X is : (Given atomic masses of A = 64; B = 40; C = 32 u)

    Tap an option to check your answer.

Biology

100 questions

  1. 101
    Match List I with List II
    List-IList-II
    A.RhizopusI.Mushroom
    B.UstilagoII.Smut fungus
    C.PucciniaIII.Bread mould
    D.AgaricusIV.Rust fungus
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  2. 102
    Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

    Tap an option to check your answer.

  3. 103
    Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

    Tap an option to check your answer.

  4. 104
    Match List I with List II
    List IList II
    A.Two or more alternative forms of a geneI.Back cross
    B.Cross of F1 progeny with homozygous recessive parentII.Ploidy
    C.Cross of F1 progeny with any of the parentsIII.Allele
    D.Number of chromosome sets in plantIV.Test cross
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  5. 105
    A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

    Tap an option to check your answer.

  6. 106
    Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

    Tap an option to check your answer.

  7. 107
    These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation E. Migration Choose the correct option:

    Tap an option to check your answer.

  8. 108
    Match List I with List II
    List IList II
    A.Clostridium butylicumI.Ethanol
    B.Saccharomyces cerevisiaeII.Streptokinase
    C.Trichoderma polysporumIII.Butyric acid
    D.Streptococcus sp.IV.Cyclosporin-A
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  9. 109
    Spindle fibers attach to kinetochores of chromosomes during

    Tap an option to check your answer.

  10. 110
    Which of the following is an example of actinomorphic flower?

    Tap an option to check your answer.

  11. 111
    The cofactor of the enzyme carboxypeptidase is:

    Tap an option to check your answer.

  12. 112
    Match List I with List II
    List-IList-II
    A.NucleolusI.Site of formation of glycolipid
    B.CentrioleII.Organization like the cartwheel
    C.LeucoplastsIII.Site for active ribosomal RNA synthesis
    D.Golgi apparatusIV.For storing nutrients
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  13. 113
    The capacity to generate a whole plant from any cell of the plant is called:

    Tap an option to check your answer.

  14. 114
    Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

    Tap an option to check your answer.

  15. 115
    Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar. B. The flowers of water lily are not pollinated by water. C. In most of water-pollinated species, the pollen grains are protected from wetting. D. Pollen grains of some hydrophytes are long and ribbon like. E. In some hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options given below.

    Tap an option to check your answer.

  16. 116
    Given below are two statements: Statement I : Parenchyma is living but collenchyma is dead tissue. Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. In the light of the above statements, choose the correct answer from the options given below:

    Tap an option to check your answer.

  17. 117
    Formation of interfascicular cambium from fully developed parenchyma cells is an example for

    Tap an option to check your answer.

  18. 118
    Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

    Tap an option to check your answer.

  19. 119
    Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)

    Tap an option to check your answer.

  20. 120
    In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

    Tap an option to check your answer.

  21. 121
    Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification. B. Tropical environments are more seasonal. C. More solar energy is available in tropics. D. Constant environments promote niche specialization. E. Tropical environments are constant and predictable. Choose the correct answer from the options given below.

    Tap an option to check your answer.

  22. 122
    The equation of Verhulst-Pearl logistic growth is dNdt=rN[K−NK]\frac{dN}{dt} = rN\left[\frac{K-N}{K}\right]. From this equation, K indicates:

    Tap an option to check your answer.

  23. 123
    In the given figure, which component has thin outer walls and highly thickened inner walls?

    Tap an option to check your answer.

  24. 124
    Given below are two statements: Statement I : Chromosomes become gradually visible under light microscope during leptotene stage. Statement II : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex. In the light of the above statements, choose the correct answer from the options given below:

    Tap an option to check your answer.

  25. 125
    List of endangered species was released by

    Tap an option to check your answer.

  26. 126
    Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO2 D. ATP E. NADPH Choose the correct answer from the options given below:

    Tap an option to check your answer.

  27. 127
    The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called

    Tap an option to check your answer.

  28. 128
    What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism. B. It may get integrated into the genome of the recipient. C. It may multiply and be inherited along with the host DNA. D. The alien piece of DNA is not an integral part of chromosome. E. It shows ability to replicate. Choose the correct answer from the options given below:

    Tap an option to check your answer.

  29. 129
    The lactose present in the growth medium of bacteria is transported to the cell by the action of

    Tap an option to check your answer.

  30. 130
    Which one of the following can be explained on the basis of Mendel's Law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the characters appear as such in F2 generation. C. Factors occur in pairs in normal diploid plants. D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross. Choose the correct answer from the options given below:

    Tap an option to check your answer.

  31. 131
    Which one of the following is not a criterion for classification of fungi?

    Tap an option to check your answer.

  32. 132
    Given below are two statements: Statement I : Bt toxins are insect group specific and coded by a gene cry IAc. Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut. In the light of the above statements, choose the correct answer from the options given below:

    Tap an option to check your answer.

  33. 133
    Bulliform cells are responsible for

    Tap an option to check your answer.

  34. 134
    A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

    Tap an option to check your answer.

  35. 135
    How many molecules of ATP and NADPH are required for every molecule of CO2 fixed in the Calvin cycle?

    Tap an option to check your answer.

  36. 136
    Match List I with List II
    List IList II
    A.Robert MayI.Species-Area relationship
    B.Alexander von HumboldtII.Long term ecosystem experiment using out door plots
    C.Paul EhrlichIII.Global species diversity at about 7 million
    D.David TilmanIV.Rivet popper hypothesis
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  37. 137
    Identify the correct description about the given figure:

    Tap an option to check your answer.

  38. 138
    Match List I with List II
    List IList II
    A.Frederick GriffithI.Genetic code
    B.Francois Jacob & Jacque MonodII.Semi-conservative mode of DNA replication
    C.Har Gobind KhoranaIII.Transformation
    D.Meselson & StahlIV.Lac operon
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  39. 139
    Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

    Tap an option to check your answer.

  40. 140
    Match List I with List II
    List IList II
    A.RoseI.Twisted aestivation
    B.PeaII.Perigynous flower
    C.CottonIII.Drupe
    D.MangoIV.Marginal placentation
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  41. 141
    Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is by oogamous method only. C. Stored food is in the form of carbohydrates which is either mannitol or laminarin. D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll. E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. Choose the correct answer from the options given below:

    Tap an option to check your answer.

  42. 142
    Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

    Tap an option to check your answer.

  43. 143
    Given below are two statements: Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased. Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration. In the light of the above statements, choose the correct answer from the options given below:

    Tap an option to check your answer.

  44. 144
    Match List-I with List-II
    List-IList-II
    A.GLUT-4I.Hormone
    B.InsulinII.Enzyme
    C.TrypsinIII.Intercellular ground substance
    D.CollagenIV.Enables glucose transport into cells
    Choose the correct answer from the options given below.

    Tap an option to check your answer.

  45. 145
    Match List I with List II
    List I (Types of Stamens)List II (Example)
    A.MonoadelphousI.Citrus
    B.DiadelphousII.Pea
    C.PolyadelphousIII.Lily
    D.EpiphyllousIV.China-rose
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  46. 146
    The DNA present in chloroplast is:

    Tap an option to check your answer.

  47. 147
    In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m⁻²) yr⁻¹, what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

    Tap an option to check your answer.

  48. 148
    Which of the following are fused in somatic hybridization involving two varieties of plants?

    Tap an option to check your answer.

  49. 149
    Match List I with List II
    List IList II
    A.Citric acid cycleI.Cytoplasm
    B.GlycolysisII.Mitochondrial matrix
    C.Electron transport systemIII.Intermembrane space of mitochondria
    D.Proton gradientIV.Inner mitochondrial membrane
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  50. 150
    Which of the following statement is correct regarding the process of replication in E.coli?

    Tap an option to check your answer.

  51. 151
    Which of the following is not a steroid hormone?

    Tap an option to check your answer.

  52. 152
    Given below are two statements: Statement I: The presence or absence of hymen is not a reliable indicator of virginity. Statement II: The hymen is torn during the first coitus only. In the light of the above statements, choose the correct answer from the options given below :

    Tap an option to check your answer.

  53. 153
    Which of the following statements is incorrect?

    Tap an option to check your answer.

  54. 154
    Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

    Tap an option to check your answer.

  55. 155
    Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements, choose the correct answer from the options given below :

    Tap an option to check your answer.

  56. 156
    Match List I with List II
    List IList II
    A.TyphoidI.Fungus
    B.LeishmaniasisII.Nematode
    C.RingwormIII.Protozoa
    D.FilariasisIV.Bacteria
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  57. 157
    Following are the stages of pathway for conduction of an action potential through the heart A. AV bundle B. Purkinje fibres C. AV node D. Bundle branches E. SA node Choose the correct sequence of pathway from the options given below

    Tap an option to check your answer.

  58. 158
    Match List I with List II :
    List I (Sub Phases of Prophase I)List II (Specific Characters)
    A.DiakinesisI.Synaptonemal complex formation
    B.PachyteneII.Completion of terminalisation of chiasmata
    C.ZygoteneIII.Chromosomes look like thin threads
    D.LeptoteneIV.Appearance of recombination nodules
    Choose the correct answer from the options given below

    Tap an option to check your answer.

  59. 159
    Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body: Name of muscle/location

    Tap an option to check your answer.

  60. 160
    Match List I with List II
    List IList II
    A.Non-medicated IUDI.Multiload 375
    B.Copper releasing IUDII.Progestogens
    C.Hormone releasing IUDIII.Lippes loop
    D.ImplantsIV.LNG-20
    Choose the correct answer from the option given below:

    Tap an option to check your answer.

  61. 161
    Match List I with List II :
    List-IList-II
    A.LipaseI.Peptide bond
    B.NucleaseII.Ester bond
    C.ProteaseIII.Glycosidic bond
    D.AmylaseIV.Phosphodiester bond
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  62. 162
    Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby. Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby. In the light of the above statements, choose the most appropriate answer from the options given below:

    Tap an option to check your answer.

  63. 163
    Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below:

    Tap an option to check your answer.

  64. 164
    Match List I with List II :
    List IList II
    A.AxonemeI.Centriole
    B.Cartwheel patternII.Cilia and flagella
    C.CristaIII.Chromosome
    D.SatelliteIV.Mitochondria
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  65. 165
    Match List I with List II :
    List IList II
    A.PterophyllumI.Hag fish
    B.MyxineII.Saw fish
    C.PristisIII.Angel fish
    D.ExocoetusIV.Flying fish
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  66. 166
    Match List I with List II :
    List IList II
    A.α\alpha–I antitrypsinI.Cotton bollworm
    B.Cry IAbII.ADA deficiency
    C.Cry IAcIII.Emphysema
    D.Enzyme replacement therapyIV.Corn borer
    Choose the correct answer form the options given below:

    Tap an option to check your answer.

  67. 167
    The "Ti plasmid" of Agrobacterium tumefaciens stands for

    Tap an option to check your answer.

  68. 168
    Match List I with List II :
    List IList II
    A.PleurobrachiaI.Mollusca
    B.RadulaII.Ctenophora
    C.StomochordIII.Osteichthyes
    D.Air bladderIV.Hemichordata
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  69. 169
    Which of the following is not a natural/traditional contraceptive method?

    Tap an option to check your answer.

  70. 170
    Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below :

    Tap an option to check your answer.

  71. 171
    Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

    Tap an option to check your answer.

  72. 172
    Match List I with List II :
    List IList II
    A.PonsI.Provides additional space for Neurons, regulates posture and balance.
    B.HypothalamusII.Controls respiration and gastric secretions.
    C.MedullaIII.Connects different regions of the brain.
    D.CerebellumIV.Neuro secretory cells
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  73. 173
    Match List I with List II :
    List IList II
    A.Expiratory capacityI.Expiratory reserve volume + Tidal volume + Inspiratory reserve volume
    B.Functional residual capacityII.Tidal volume + Expiratory reserve volume
    C.Vital capacityIII.Tidal volume + Inspiratory reserve volume
    D.Inspiratory capacityIV.Expiratory reserve volume + Residual volume
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  74. 174
    Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE) Choose the most appropriate answer from the options given below:

    Tap an option to check your answer.

  75. 175
    Which of the following is not a component of Fallopian tube?

    Tap an option to check your answer.

  76. 176
    Match List I with List II :
    List IList II
    A.Fibrous jointsI.Adjacent vertebrae, limited movement
    B.Cartilaginous jointsII.Humerus and Pectoral girdle, rotational movement
    C.Hinge jointsIII.Skull, don't allow any movement
    D.Ball and socket jointsIV.Knee, help in locomotion
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  77. 177
    The flippers of the Penguins and Dolphins are the example of the

    Tap an option to check your answer.

  78. 178
    Given below are two statements : Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes. Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption. In the light of the above statements, choose the correct answer from the option given below :

    Tap an option to check your answer.

  79. 179
    In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on

    Tap an option to check your answer.

  80. 180
    Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

    Tap an option to check your answer.

  81. 181
    The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of 'X' and 'Y' genes :

    Tap an option to check your answer.

  82. 182
    Match List I with List II :
    List IList II
    A.Down's syndromeI.11th11^{th} chromosome
    B.α\alpha-ThalassemiaII.'X' chromosome
    C.β\beta-ThalassemiaIII.21st21^{st} chromosome
    D.Klinefelter's syndromeIV.16th16^{th} chromosome
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  83. 183
    Consider the following statements : A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D. Platyhelminthes are pseudocoelomates Choose the correct answer from the options given below :

    Tap an option to check your answer.

  84. 184
    Match List I with List II :
    List IList II
    A.Common coldI.Plasmodium
    B.HaemozoinII.Typhoid
    C.Widal testIII.Rhinoviruses
    D.AllergyIV.Dust mites
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  85. 185
    Match List I with List II :
    List IList II
    A.CocaineI.Effective sedative in surgery
    B.HeroinII.Cannabis sativa
    C.MorphineIII.Erythroxylum
    D.MarijuanaIV.Papaver somniferum
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  86. 186
    Given below are two statements: Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely. Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting. In the light of the above statements, choose the correct answer from the options given below :

    Tap an option to check your answer.

  87. 187
    The following are the statements about non-chordates: A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous system is dorsal. D. Heart is dorsal if present. E. Post anal tail is absent. Choose the most appropriate answer from the options given below:

    Tap an option to check your answer.

  88. 188
    Given below are two statements: Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum. Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum. In the light of the above statements, choose the most appropriate answer from the options given below:

    Tap an option to check your answer.

  89. 189
    Match List I with List II related to digestive system of cockroach.
    List IList II
    A.The structures used for storing of foodI.Gizzard
    B.Ring of 6-8 blind tubules at junction of foregut and midgut.II.Gastric Caeca
    C.Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut.III.Malpighian tubules
    D.The structures used for grinding the food.IV.Crop
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  90. 190
    Match List I with List II :
    List IList II
    A.Exophthalmic goiterI.Excess secretion of cortisol, moon face & hypergylcemia.
    B.AcromegalyII.Hypo-secretion of thyroid hormone and stunted growth.
    C.Cushing's syndromeIII.Hyper secretion of thyroid hormone & protruding eye balls.
    D.CretinismIV.Excessive secretion of growth hormone.
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  91. 191
    Choose the correct statement given below regarding juxta medullary nephron.

    Tap an option to check your answer.

  92. 192
    Regarding catalytic cycle of an enzyme action, select the correct sequential steps : A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release of products. D. Chemical bonds of the substrate broken. E. Substrate binding to active site. Choose the correct answer from the options given below :

    Tap an option to check your answer.

  93. 193
    Match List I with List II:
    List IList II
    A.Unicellular glandular epitheliumI.Salivary glands
    B.Compound epitheliumII.Pancreas
    C.Multicellular glandular epitheliumIII.Goblet cells of alimentary canal
    D.Endocrine glandular epitheliumIV.Moist surface of buccal cavity
    Choose the correct answer from the options given below:

    Tap an option to check your answer.

  94. 194
    Match List I with List II:
    List IList II
    A.Mesozoic EraI.Lower invertebrates
    B.Proterozoic EraII.Fish & Amphibia
    C.Cenozoic EraIII.Birds & Reptiles
    D.Paleozoic EraIV.Mammals
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  95. 195
    Given below are two statements: Statement I: Mitochondria and chloroplasts both double membranes bound organelles. Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast. In the light of the above statements, choose the mis appropriate answer from the options given below:

    Tap an option to check your answer.

  96. 196
    Match List I with List II :
    List IList II
    A.P waveI.Heart muscles are electrically silent.
    B.QRS complexII.Depolarisation of ventricles.
    C.T waveIII.Depolarisation of atria.
    D.T-P gapIV.Repolarisation of ventricles.
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

  97. 197
    Given below are two statements : Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced. Statement II : Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes. In the light of above statements, choose the most appropriate answer from the options given below :

    Tap an option to check your answer.

  98. 198
    Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

    Tap an option to check your answer.

  99. 199
    As per ABO blood grouping system, the blood group of father is B+^+, mother is A+^+ and child is O+^+. Their respective genotype can be A. IBi/IAi/iiI^B i / I^A i / ii B. IBIB/IAIA/iiI^B I^B / I^A I^A / ii C. IAIB/iIA/IBiI^A I^B / i I^A / I^B i D. IAi/IBi/IAiI^A i / I^B i / I^A i E. iIB/iIA/IAIBi I^B / i I^A / I^A I^B Choose the most appropriate answer from the options given below :

    Tap an option to check your answer.

  100. 200
    Match List I with List II:
    List IList II
    A.RNA polymerase IIII.snRNPs
    B.Termination of transcriptionII.Promotor
    C.Splicing of ExonsIII.Rho factor
    D.TATA boxIV.SnRNAs, tRNA
    Choose the correct answer from the options given below :

    Tap an option to check your answer.

Want the real exam feel? Sit this paper with a 200-minute timer and get your score straight away.

Sit it as a timed mock