CBSE Class 12 Biology 2025 question paper (57/4)

Maximum marks 70 · Time 3 hours · 3 sets

Try each question first, then open its model answer. Where the paper offers a choice, both questions are shown with OR between them.

Section A

1 mark each

Q.11 mark $In its extended 'beads-on-string' form of chromatin, the 'beads' in the string represent :$
Tap an option to check your answer.
Q.21 mark $Given below are a few statements with reference to the accessory ducts of the human male reproductive system : (i) The seminiferous tubules of the testes open into rete testis then into the vas deferens. (ii) The vasa efferentia leave the testes and open into the epididymis. (iii) The epididymis leads to vas deferens that ascends into the abdomen. (iv) The vas deferens receives a duct from the prostrate gland and opens into the urethra as ejaculatory duct. (v) The urethra originates from the urinary bladder and extends through the penis to its external opening, urethral meatus. Choose the option with all true statements from the given options :$
Tap an option to check your answer.
Q.31 mark $The substrate used during DNA replication by the enzyme DNA-dependent DNA polymerase is :$
Tap an option to check your answer.
Q.41 mark $In the given pedigree chart, a cross between a normal couple resulted in a son who was haemophilic and a normal daughter. In course of time, when the daughter was married to a normal man, to their surprise the grandson was also haemophilic. Choose the option that indicates the correct inheritance of trait in the above pedigree chart :$
Tap an option to check your answer.
Q.51 mark $In which of the following human diseases does the body's self-defence mechanism attack self-cells ?$
Tap an option to check your answer.
Q.61 mark $Select the statements that are true for a typical dicotyledonous embryo from the given options. (i) It consists of an embryonal axis and scutellum. (ii) The portion of embryonal axis above the level of cotyledon is epicotyl. (iii) The portion of embryonal axis below the level of cotyledon is coleorhiza. (iv) The lower end of the embryo has radicle covered with a root cap. Choose the correct answer :$
Tap an option to check your answer.
Q.71 mark $About 15 mya during human evolution, the primates which used to walk like gorillas and chimpanzees were :$
Tap an option to check your answer.
Q.81 mark $Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the structural gene being transcribed has the nucleotide sequence TAC. Codons for the amino acids : AUC - Isoleucine AUG - Methionine UAC - Tyrosine GUA - Valine$
Tap an option to check your answer.
Q.91 mark $The technique for the early detection of a disease based on the principle of antigen-antibody interaction is :$
Tap an option to check your answer.
Q.101 mark $The correct depiction of the experiment performed by Matthew Meselson and Franklin Stahl to prove that DNA replicates semi-conservatively on separation of DNA by centrifugation after 40 minutes is :$
Tap an option to check your answer.
Q.111 mark $Bioactive molecule Cyclosporin A used for human welfare is derived from :$
Tap an option to check your answer.
Q.121 mark $In a pea plant (Pisum sativum) inflated pod shape is dominant over constricted pod shape. The expected ratio of phenotypes of the offspring in a cross between both the parents with heterozygous inflated pod shape will be :$
Tap an option to check your answer.
For Questions number 13 to 16, two statements are given – one labelled as Assertion (A) and the other labelled as Reason (R). Select the correct answer to these questions from the codes (A), (B), (C) and (D) as given below.
Q.131 mark $Assertion (A) : The meristems are grown 'in vitro' to obtain virus-free plants from an infected plant. Reason (R) : If the plant is infected with a virus, the roots and the stems are free of virus.$
Tap an option to check your answer.
Q.141 mark $Assertion (A) : A person infected with malaria suffers from chill and high fever, recurring every three or four days. Reason (R) : The parasite attacks the RBC resulting in their rupture and release of haemozoin.$
Tap an option to check your answer.
Q.151 mark $Assertion (A) : 'Saheli', an oral contraceptive inhibits ovulation and increases phagocytosis of sperms. Reason (R) : It is a non-steroidal preparation.$
Tap an option to check your answer.
Q.161 mark $Assertion (A) : ABO blood grouping in humans is an example of multiple allelism. Reason (R) : More than two genes in a population govern the same character in ABO blood grouping in humans.$
Tap an option to check your answer.

Section B

2 marks each

Q.17 (a)2 marks $Explain how the immunity of a person is affected if there is atrophy (degeneration) of the thymus gland at an early stage of life.$
OR
Q.17 (b)2 marks $(i) What are interferons ? Explain their role in providing immunity to a person. (ii) Which category of innate immunity defence barrier can interferons be classified into ?$
Q.182 marks $Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. (a) Translation starting from the first nucleotide (Reading frame 1) (b) Translation starting from the second nucleotide (Reading frame 2) Frame 1 5' - CUCGCUUGCCGAUCAAGGGUUA - 3' Frame 2 5' - GUGGCACUCAGUCCUUAAUGGCG - 3' Answer the following question : How many amino acids will be specified in case (a) and case (b) on translation ? Justify your answer.$
Q.19 (a)2 marks $Explain what is meant by the term MTP. What was the main reason to legalize MTP by the Government of India ?$
OR
Q.19 (b)2 marks $Name any two STIs which might occur in a human female. State its two early symptoms.$
Q.202 marks $\downarrow$
Q.21 (a)2 marks $Explain how the interaction between sea anemone and clownfish is one of the best examples of commensalism in nature.$
OR
Q.21 (b)2 marks $Correctly depict (also indicate the trophic level) and describe the ecological pyramid of biomass in sea with 40 standing crop of phytoplankton supporting 90 standing crop of zooplankton which further supports 120 small fishes.$

Section C

3 marks each

Q.223 marks $Explain the process of formation of placenta in a human female after the implantation of the blastocyst in the endometrium of the uterus.$
Q.233 marks $Gregor Mendel conducted hybridisation experiments in garden pea for seven years and proposed the law of inheritance. (a) Why was he successful in his hybridisation experiments ? Give two reasons. (b) State the law of independent assortment as proposed by Mendel after his dihybrid crosses.$
Q.243 marks $Study the given below single strand of deoxyribonucleic acid depicted in the form of a "stick" diagram with 5' - 3' end directionality, sugars as vertical lines and bases as single letter abbreviations and answer the questions that follow. (a) Name the covalent bonds depicted as (a) and (b) in the form of slanting lines in the diagram. (b) How many purines are present in the given "stick" diagram ? (c) Draw the chemical structure of the given polynucleotide chain of DNA.$
Q.253 marks $Explain the biological treatment of primary effluent when passed into the large aeration tanks in a sewage treatment plant (STP).$
Q.263 marks $Given below is a flower with its characteristic features specialised for the most common type of abiotic pollination. Answer the following questions based on the above diagram : (a) Name the mode of abiotic pollination that will be adopted by the given plant species in the above picture. (b) State the need of exposed large feathery stigmas for the flower. (c) What will be the two important adaptations in the pollen grains of the flowers pollinated by the above mode of pollination ? (d) What could be the probable reason for the petals being small and non-green ?$
Q.273 marks $According to a recent wildlife report, the biggest threat to the tiger's survival in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub, that invaded 40% of India's tiger range. Tamil Nadu department's Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes. Answer the given questions based on the information given above. (a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve. (b) Why is the invasion of Lantana camara a cause of concern in MTR.$
Q.283 marks $Enlist one advantage and two disadvantages of green revolution.$

Section D

The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow.
S.No. Animal No. of amino acid differences in haemoglobin with that of humans
1. Macaque 08
2. Dog 32
3. Bird 45
4. Frog 67
5. Lamprey 125
Q.29 (a)1 mark $To which category of evolution (Divergent or Convergent) do the following evolutionary relationships belong to : (i) Humans and Macaque (ii) Humans and Frog$
Q.29 (b)1 mark $What do the biochemical similarities in haemoglobin suggest about the evolutionary relationship between humans, frog and lamprey ?$
Q.29 (c)(i)2 marks $Which one of the two - lampreys' or macaques' evolution is more closely related to humans and why ?$
OR
Q.29 (c)(ii)2 marks $Which one of the two - frogs' or dogs' evolution is more closely related to humans and why ?$
Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, $17{\cdot}5$ percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.
Q.30 (a)1 mark $Why are people taking opioids more prone to liver diseases attributed to Hepatitis B ?$
Q.30 (b)1 mark $What is meant by direct drug-related disease ?$
Q.30 (c)(i)2 marks $What is the scientific name of the plant from which the opioids are derived and from which part of the plant is it extracted ?$
OR
Q.30 (c)(ii)2 marks $State two common warning signs of drug abuse among the youth.$

S.No.	Animal	No. of amino acid differences in haemoglobin with that of humans
1.	Macaque	08
2.	Dog	32
3.	Bird	45
4.	Frog	67
5.	Lamprey	125

Section E

5 marks each

Q.31 (a)5 marks $(i) Explain how does double fertilisation take place in a flowering plant. (ii) Write the fate of the products of double fertilization in these plants.$
OR
Q.31 (b)5 marks $(i) Explain the structure of testicular lobules in human male reproductive system. Name the two types of cells present in the seminiferous tubules and state their role. (ii) Describe the role of hypothalamic hormone GnRH in spermatogenesis.$
Q.32 (a)5 marks $Name and explain the biotechnological strategy wherein the infection by the nematode Meloidegyne incognitia can be prevented using Agrobacterium vectors in the roots of tobacco plant by RNA interference.$
OR
Q.32 (b)5 marks $Explain the amplification of gene of interest using the technique of Polymerase chain reaction (PCR).$
Q.33 (a)5 marks $(i) Describe the population growth curve applicable in a population of any species in nature that has limited resources at its disposal. (ii) Give the equation of this growth curve. (iii) Name the growth curve and depict a graphical plot for this type of population growth.$
OR
Q.33 (b)5 marks $(i) Explain the Species-Area relationship within a natural forest and also predict the nature of graph when species richness is plotted against the area for a wide variety of taxa. (ii) Depict the graphical relationship between species richness and area. (iii) Give the equation of the Species-Area relationship for a wide variety of taxa on a logarithmic scale.$

Section A

1 mark each

Q.11 mark $In its extended 'beads-on-string' form of chromatin, the 'beads' are composed of :$
Tap an option to check your answer.
Q.21 mark $Given below are few statements with respect to the process of oogenesis in a human ovary : (i) Each granulosa cell gets surrounded by a primary oocyte to form the primary follicle. (ii) A couple of million of oogonia are formed within each fetal ovary during the embryonic development. (iii) Tertiary follicle is characterised by antrum and theca layers. (iv) Secondary follicles form a zona pellucida layer around it. (v) Mature graafian follicle ruptures to release the secondary oocyte from the ovary. Choose the option with all true statements from the given options :$
Tap an option to check your answer.
Q.31 mark $The simplest definition of a gene in eukaryotes is - A unit of DNA that has information to mainly specify the synthesis of :$
Tap an option to check your answer.
Q.41 mark $A colourblind man marries a woman with normal sight who has no history of colourblindness in her family. What is the probability of their son being colourblind ?$
Tap an option to check your answer.
Q.51 mark $The type of antibodies produced during an immune response to allergens as dust and pollen grains in a person is :$
Tap an option to check your answer.
Q.61 mark $Select the statements that are true for a typical megasporangium of flowering plants. (i) It is attached to the placenta by hilum. (ii) It has a chalaza end that represents the basal part of the ovule. (iii) It has nucellus enclosed by integuments. (iv) Its micropylar end is known as chalaza. Choose the correct answer :$
Tap an option to check your answer.
Q.71 mark $The primates that probably lived in East Africa grasslands about two mya were :$
Tap an option to check your answer.
Q.81 mark $Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the structural gene being transcribed has the nucleotide sequence 'ATA'. Codons for the amino acids : UAU - Tyrosine AUG - Methionine AUA - Isoleucine AGU - Serine$
Tap an option to check your answer.
Q.91 mark $Early detection of HIV in suspected AIDS patients can be done using the diagnostic technique of :$
Tap an option to check your answer.
Q.101 mark $The correct depiction of the experiment performed by Matthew Meselson and Franklin Stahl to prove that DNA replicates semi-conservatively on separation of DNA by centrifugation after 40 minutes is :$
Tap an option to check your answer.
Q.111 mark $Large holes in 'Swiss cheese' are formed by the activity of microbes :$
Tap an option to check your answer.
Q.121 mark $In pea plant (Pisum sativum) axial flower position is dominant over terminal flower position. The expected ratio of phenotypes of the offspring in a cross between both the parents with heterozygous axial flower will be :$
Tap an option to check your answer.
For Questions number 13 to 16, two statements are given – one labelled as Assertion (A) and the other labelled as Reason (R). Select the correct answer to these questions from the codes (A), (B), (C) and (D) as given below.
Q.131 mark $Assertion (A) : 'Saheli', an oral contraceptive inhibits ovulation and increases phagocytosis of sperms. Reason (R) : It is a non-steroidal preparation.$
Tap an option to check your answer.
Q.141 mark $Assertion (A) : The meristems are grown 'in vitro' to obtain virus-free plants from an infected plant. Reason (R) : If the plant is infected with a virus, the roots and the stems are free of virus.$
Tap an option to check your answer.
Q.151 mark $Assertion (A) : ABO blood grouping in humans is an example of multiple allelism. Reason (R) : More than two genes in a population govern the same character in ABO blood grouping in humans.$
Tap an option to check your answer.
Q.161 mark $Assertion (A) : A person infected with malaria suffers from chill and high fever, recurring every three or four days. Reason (R) : The parasite attacks the RBC resulting in their rupture and release of haemozoin.$
Tap an option to check your answer.

Section B

2 marks each

Q.172 marks $\downarrow$
Q.18 (a)2 marks $Explain how the interaction between sea anemone and clownfish is one of the best examples of commensalism in nature.$
OR
Q.18 (b)2 marks $Correctly depict (also indicate the trophic level) and describe the ecological pyramid of biomass in sea with 40 standing crop of phytoplankton supporting 90 standing crop of zooplankton which further supports 120 small fishes.$
Q.192 marks $Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. (a) Translation starting from the first nucleotide (Reading frame 1) (b) Translation starting from the second nucleotide (Reading frame 2) Frame 1 5' - CUCGCUUGCCGAUCAAGGGUUA - 3' Frame 2 5' - GUGGCACUCAGUCCUUAAUGGCG - 3' Answer the following question : How many amino acids will be specified in case (a) and case (b) on translation ? Justify your answer.$
Q.20 (a)2 marks $Explain how the immunity of a person is affected if there is atrophy (degeneration) of the thymus gland at an early stage of life.$
OR
Q.20 (b)2 marks $(i) What are interferons ? Explain their role in providing immunity to a person. (ii) Which category of innate immunity defence barrier can interferons be classified into ?$
Q.21 (a)2 marks $Write two features of an ideal contraceptive. Explain any one natural contraceptive method that makes the chances of conception almost nil.$
OR
Q.21 (b)2 marks $Explain GIFT and ICSI.$

Section C

3 marks each

Q.223 marks $Explain the biological treatment of primary effluent when passed into the large aeration tanks in a sewage treatment plant (STP).$
Q.233 marks $Given below is a flower with its characteristic features specialised for the most common type of abiotic pollination. Answer the following questions based on the above diagram : (a) Name the mode of abiotic pollination that will be adopted by the given plant species in the above picture. (b) State the need of exposed large feathery stigmas for the flower. (c) What will be the two important adaptations in the pollen grains of the flowers pollinated by the above mode of pollination ? (d) What could be the probable reason for the petals being small and non-green ?$
Q.243 marks $Enlist one advantage and two disadvantages of green revolution.$
Q.253 marks $Study the given below single strand of deoxyribonucleic acid depicted in the form of a "stick" diagram with 5' - 3' end directionality, sugars as vertical lines and bases as single letter abbreviations and answer the questions that follow. (a) Name the covalent bonds depicted as (a) and (b) in the form of slanting lines in the diagram. (b) How many purines are present in the given "stick" diagram ? (c) Draw the chemical structure of the given polynucleotide chain of DNA.$
Q.263 marks $Thomas Hunt Morgan carried out several dihybrid crosses in Drosophila melanogaster to study genes that were sex linked. (a) Give four major reasons for using the tiny fruit flies by Morgan for his experiments. (b) How did Morgan and his group explain the physical association of the two genes on a chromosome to the frequency of recombination between gene pairs on the same chromosome ?$
Q.273 marks $Explain the process of formation of placenta in a human female after the implantation of the blastocyst in the endometrium of the uterus.$
Q.283 marks $According to a recent wildlife report, the biggest threat to the tiger's survival in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub, that invaded 40% of India's tiger range. Tamil Nadu department's Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes. Answer the given questions based on the information given above. (a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve. (b) Why is the invasion of Lantana camara a cause of concern in MTR.$

Section D

Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, $17{\cdot}5$ percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.
Q.29 (a)1 mark $Why are people taking opioids more prone to liver diseases attributed to Hepatitis B ?$
Q.29 (b)1 mark $What is meant by direct drug-related disease ?$
Q.29 (c)(i)2 marks $What is the scientific name of the plant from which the opioids are derived and from which part of the plant is it extracted ?$
OR
Q.29 (c)(ii)2 marks $State two common warning signs of drug abuse among the youth.$
The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow.
S.No. Animal No. of amino acid differences in haemoglobin with that of humans
1. Macaque 08
2. Dog 32
3. Bird 45
4. Frog 67
5. Lamprey 125
Q.30 (a)1 mark $To which category of evolution (Divergent or Convergent) do the following evolutionary relationships belong to : (i) Humans and Macaque (ii) Humans and Frog$
Q.30 (b)1 mark $What do the biochemical similarities in haemoglobin suggest about the evolutionary relationship between humans, frog and lamprey ?$
Q.30 (c)(i)2 marks $Which one of the two - lampreys' or macaques' evolution is more closely related to humans and why ?$
OR
Q.30 (c)(ii)2 marks $Which one of the two - frogs' or dogs' evolution is more closely related to humans and why ?$

S.No.	Animal	No. of amino acid differences in haemoglobin with that of humans
1.	Macaque	08
2.	Dog	32
3.	Bird	45
4.	Frog	67
5.	Lamprey	125

Section E

5 marks each

Q.31 (a)5 marks $(i) Describe the population growth curve applicable in a population of any species in nature that has limited resources at its disposal. (ii) Give the equation of this growth curve. (iii) Name the growth curve and depict a graphical plot for this type of population growth.$
OR
Q.31 (b)5 marks $(i) Explain the Species-Area relationship within a natural forest and also predict the nature of graph when species richness is plotted against the area for a wide variety of taxa. (ii) Depict the graphical relationship between species richness and area. (iii) Give the equation of the Species-Area relationship for a wide variety of taxa on a logarithmic scale.$
Q.32 (a)5 marks $(i) Explain how does double fertilisation take place in a flowering plant. (ii) Write the fate of the products of double fertilization in these plants.$
OR
Q.32 (b)5 marks $(i) Explain the structure of testicular lobules in human male reproductive system. Name the two types of cells present in the seminiferous tubules and state their role. (ii) Describe the role of hypothalamic hormone GnRH in spermatogenesis.$
Q.33 (a)5 marks $(i) Name the two genes encoding for the Bt toxin protein used in biotechnology for the control of cotton bollworms. (ii) How does the expression of Bt toxin gene in Bt cotton plant help in providing resistance to cotton bollworms ? Explain.$
OR
Q.33 (b)5 marks $(i) Explain the given methods of introducing the alien DNA in the host cells : (I) Biolistics (II) Microinjection (ii) How is E. coli made 'competent' to take up a recombinant plasmid or DNA ?$

Section A

1 mark each

Q.11 mark $In its extended 'beads-on-string' form of chromatin, the 'string' in the 'beads-on-string' represent :$
Tap an option to check your answer.
Q.21 mark $Given below are few statements with reference to oogenesis in a human female : (i) An unequal division of the primary oocyte forms a large secondary oocyte and a tiny first polar body. (ii) A couple of thousands of oogonia are formed within each fetal ovary during embryonic development. (iii) Primary oocytes start meiosis-I but it gets arrested temporarily at prophase-I during fetal development. (iv) Fertilisation induces the completion of the meiotic division of the secondary oocyte. (v) A primary oocyte on meiosis forms an ovum and a polar body. Choose the option with all true statements from the given options :$
Tap an option to check your answer.
Q.31 mark $Thalassemia and Sickle Cell Anaemia are both caused due to problem in globin molecule synthesis. Select the correct statement :$
Tap an option to check your answer.
Q.41 mark $A pedigree chart in shown below for a disease that is autosomal dominant. The genetic make-up of the first generation is :$
Tap an option to check your answer.
Q.51 mark $Allergy in humans is a result of release of the following chemicals from the mast cells :$
Tap an option to check your answer.
Q.61 mark $Select the statements that are true for outbreeding devices in the flowering plants. (i) They discourage cross-pollination and ensure self-pollination. (ii) They are advantageous as they lead to inbreeding depression. (iii) Self-incompatibility prevents self-pollen from fertilising the ovules. (iv) To prevent self-pollination in some species pollen release and stigma receptivity are not synchronised. Choose the correct answer :$
Tap an option to check your answer.
Q.71 mark $The first human-like homonid evolved during human evolution is supposed to be :$
Tap an option to check your answer.
Q.81 mark $Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the structural gene being transcribed has the nucleotide sequence 'TCC'. Codons for the amino acids : AGG - Arginine AAG - Lysine UCC - Serine GGA - Glycine$
Tap an option to check your answer.
Q.91 mark $The most widely used transgenic animal for testing the safety of vaccine before they are used in humans is :$
Tap an option to check your answer.
Q.101 mark $The correct depiction of the experiment performed by Matthew Meselson and Franklin Stahl to prove that DNA replicates semi-conservatively on separation of DNA by centrifugation after 40 minutes is :$
Tap an option to check your answer.
Q.111 mark $Bioactive molecule statins used for human welfare are derived from :$
Tap an option to check your answer.
Q.121 mark $In a pea plant (Pisum sativum) green pod colour is dominant over yellow pod colour. The expected ratio of phenotypes of the first generation offspring in a cross between both the parents with heterozygous green pod colour will be :$
Tap an option to check your answer.
For Questions number 13 to 16, two statements are given – one labelled as Assertion (A) and the other labelled as Reason (R). Select the correct answer to these questions from the codes (A), (B), (C) and (D) as given below.
Q.131 mark $Assertion (A) : ABO blood grouping in humans is an example of multiple allelism. Reason (R) : More than two genes in a population govern the same character in ABO blood grouping in humans.$
Tap an option to check your answer.
Q.141 mark $Assertion (A) : The meristems are grown 'in vitro' to obtain virus-free plants from an infected plant. Reason (R) : If the plant is infected with a virus, the roots and the stems are free of virus.$
Tap an option to check your answer.
Q.151 mark $Assertion (A) : A person infected with malaria suffers from chill and high fever, recurring every three or four days. Reason (R) : The parasite attacks the RBC resulting in their rupture and release of haemozoin.$
Tap an option to check your answer.
Q.161 mark $Assertion (A) : 'Saheli', an oral contraceptive inhibits ovulation and increases phagocytosis of sperms. Reason (R) : It is a non-steroidal preparation.$
Tap an option to check your answer.

Section B

2 marks each

Q.172 marks $\downarrow$
Q.18 (a)2 marks $Explain how the interaction between sea anemone and clownfish is one of the best examples of commensalism in nature.$
OR
Q.18 (b)2 marks $Correctly depict (also indicate the trophic level) and describe the ecological pyramid of biomass in sea with 40 standing crop of phytoplankton supporting 90 standing crop of zooplankton which further supports 120 small fishes.$
Q.19 (a)2 marks $Explain how the immunity of a person is affected if there is atrophy (degeneration) of the thymus gland at an early stage of life.$
OR
Q.19 (b)2 marks $(i) What are interferons ? Explain their role in providing immunity to a person. (ii) Which category of innate immunity defence barrier can interferons be classified into ?$
Q.202 marks $Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. (a) Translation starting from the first nucleotide (Reading frame 1) (b) Translation starting from the second nucleotide (Reading frame 2) Frame 1 5' - CUCGCUUGCCGAUCAAGGGUUA - 3' Frame 2 5' - GUGGCACUCAGUCCUUAAUGGCG - 3' Answer the following question : How many amino acids will be specified in case (a) and case (b) on translation ? Justify your answer.$
Q.21 (a)2 marks $(i) Write the function of each of the following : (I) Seminal Plasma (II) Acrosome of human sperm (ii) Differentiate between menarche and menopause.$
OR
Q.21 (b)2 marks $(i) How is apomixis different from parthenocarpy ? (ii) Why are apples and cashews not called true fruits ?$

Section C

3 marks each

Q.223 marks $According to a recent wildlife report, the biggest threat to the tiger's survival in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub, that invaded 40% of India's tiger range. Tamil Nadu department's Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes. Answer the given questions based on the information given above. (a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve. (b) Why is the invasion of Lantana camara a cause of concern in MTR.$
Q.233 marks $Gregor Mendel used true-breeding pea lines to conduct his hybridisation experiments in garden pea. (a) Explain what is meant by true-breeding pea lines. (b) State the three important points of law of dominance as proposed by Gregor Mendel.$
Q.243 marks $Enlist one advantage and two disadvantages of green revolution.$
Q.253 marks $Given below is a flower with its characteristic features specialised for the most common type of abiotic pollination. Answer the following questions based on the above diagram : (a) Name the mode of abiotic pollination that will be adopted by the given plant species in the above picture. (b) State the need of exposed large feathery stigmas for the flower. (c) What will be the two important adaptations in the pollen grains of the flowers pollinated by the above mode of pollination ? (d) What could be the probable reason for the petals being small and non-green ?$
Q.263 marks $Explain the process of formation of placenta in a human female after the implantation of the blastocyst in the endometrium of the uterus.$
Q.273 marks $Explain the biological treatment of primary effluent when passed into the large aeration tanks in a sewage treatment plant (STP).$
Q.283 marks $Study the given below single strand of deoxyribonucleic acid depicted in the form of a "stick" diagram with 5' - 3' end directionality, sugars as vertical lines and bases as single letter abbreviations and answer the questions that follow. (a) Name the covalent bonds depicted as (a) and (b) in the form of slanting lines in the diagram. (b) How many purines are present in the given "stick" diagram ? (c) Draw the chemical structure of the given polynucleotide chain of DNA.$

Section D

The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow.
S.No. Animal No. of amino acid differences in haemoglobin with that of humans
1. Macaque 08
2. Dog 32
3. Bird 45
4. Frog 67
5. Lamprey 125
Q.29 (a)1 mark $To which category of evolution (Divergent or Convergent) do the following evolutionary relationships belong to : (i) Humans and Macaque (ii) Humans and Frog$
Q.29 (b)1 mark $What do the biochemical similarities in haemoglobin suggest about the evolutionary relationship between humans, frog and lamprey ?$
Q.29 (c)(i)2 marks $Which one of the two - lampreys' or macaques' evolution is more closely related to humans and why ?$
OR
Q.29 (c)(ii)2 marks $Which one of the two - frogs' or dogs' evolution is more closely related to humans and why ?$
Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, $17{\cdot}5$ percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.
Q.30 (a)1 mark $Why are people taking opioids more prone to liver diseases attributed to Hepatitis B ?$
Q.30 (b)1 mark $What is meant by direct drug-related disease ?$
Q.30 (c)(i)2 marks $What is the scientific name of the plant from which the opioids are derived and from which part of the plant is it extracted ?$
OR
Q.30 (c)(ii)2 marks $State two common warning signs of drug abuse among the youth.$

S.No.	Animal	No. of amino acid differences in haemoglobin with that of humans
1.	Macaque	08
2.	Dog	32
3.	Bird	45
4.	Frog	67
5.	Lamprey	125

Section E

5 marks each

Q.31 (a)5 marks $(i) Give the full form of 'ELISA'. Write the principle on which ELISA test is based. (ii) Describe all the methods used to treat or cure Adenosine deaminase deficiency in humans.$
OR
Q.31 (b)5 marks $Explain the process of separation and isolation of DNA fragments by a typical gel electrophoresis.$
Q.32 (a)5 marks $(i) Describe the population growth curve applicable in a population of any species in nature that has limited resources at its disposal. (ii) Give the equation of this growth curve. (iii) Name the growth curve and depict a graphical plot for this type of population growth.$
OR
Q.32 (b)5 marks $(i) Explain the Species-Area relationship within a natural forest and also predict the nature of graph when species richness is plotted against the area for a wide variety of taxa. (ii) Depict the graphical relationship between species richness and area. (iii) Give the equation of the Species-Area relationship for a wide variety of taxa on a logarithmic scale.$
Q.33 (a)5 marks $(i) Explain how does double fertilisation take place in a flowering plant. (ii) Write the fate of the products of double fertilization in these plants.$
OR
Q.33 (b)5 marks $(i) Explain the structure of testicular lobules in human male reproductive system. Name the two types of cells present in the seminiferous tubules and state their role. (ii) Describe the role of hypothalamic hormone GnRH in spermatogenesis.$